View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10476_low_12 (Length: 331)
Name: NF10476_low_12
Description: NF10476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10476_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 317
Target Start/End: Complemental strand, 34794253 - 34793960
Alignment:
| Q |
14 |
aacctgtgtaaaaggaaggtaatccgtgctacctgctgtgtattgtgttaaattaaaggtctcaggaattggaaatttttatttgtttaagaggtgtatt |
113 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34794253 |
aacctgtttaaaaggaaggtaatccgtgcaacctgctgtgtattgtgttaaa-----ggtctcaggaattggaaattt--atttgtttaagaggtgtatt |
34794161 |
T |
 |
| Q |
114 |
ttatcaatttctatctagtatgaagtgtgtaattgacttggagtggtggttcttttgcttttattgtctccattcttttcnnnnnnnnnnncctagtctt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
34794160 |
ttatcaatttctatctagtatgaagtgtgtaattgacttggagtggtggttcttttgcttttactgtctccattctttt---ttttttctttctagtctt |
34794064 |
T |
 |
| Q |
214 |
tgtttgtaattttggttgagtatctcctgtagtcattgttgatcggatttattataaaattggaacaaatagcaatgagcaccatcgaatgggacggtcg |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34794063 |
tgtttgtaattttggttgagtatctcctgtactcattgttgatcggatttattataaaattggaacaaatagcaatgagcaccaacgaatgggacggtcg |
34793964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University