View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10476_low_20 (Length: 211)
Name: NF10476_low_20
Description: NF10476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10476_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 29607111 - 29606899
Alignment:
| Q |
1 |
tactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtg------------tgtctat |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29607111 |
tactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtgctgatgatggtgtgtctat |
29607012 |
T |
 |
| Q |
89 |
tgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgccggt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607011 |
tgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgccggt |
29606912 |
T |
 |
| Q |
189 |
gtttctttctctg |
201 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
29606911 |
gtttctttgtctg |
29606899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 196
Target Start/End: Complemental strand, 29606881 - 29606844
Alignment:
| Q |
159 |
ttctttttgtgtgtaggtgctggtgccggtgtttcttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
29606881 |
ttctttttgtgtgtaggtgctggtgctggtgcttcttt |
29606844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University