View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10477_low_6 (Length: 233)
Name: NF10477_low_6
Description: NF10477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10477_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 4964340 - 4964547
Alignment:
| Q |
18 |
tttatagcataatat--taaagtgtcagtgagtggaggataacatgcacttctttctattgctgttttaggaaaatatatttgaaccgttatttatttaa |
115 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4964340 |
tttatagcataatatattaaagtgtcagtgagtggaggataacatgcacttctttctattgctgttttaggaaaatatatttgaactgttatttatttaa |
4964439 |
T |
|
| Q |
116 |
tggaaaaataaacacagagagaatttagcaaccatgtcttttagcatgccaaagtagtttgcatgtgctgcaagtaaattttaatgaagaaaagtgttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4964440 |
tggaaaaataaacacagagagaatttagcaaccatgtcttttagcatgccaaagtagtttgcatgtgctgcaagtaaattttaatgaagaaaagtgttct |
4964539 |
T |
|
| Q |
216 |
gttatttg |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
4964540 |
gttatttg |
4964547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University