View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_high_15 (Length: 266)
Name: NF10478_high_15
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 253
Target Start/End: Original strand, 10562982 - 10563216
Alignment:
| Q |
19 |
aatataaagaatatatcttatgtcgtatacatatgccaaaattaattattctcagagagattaactgtatataatttgacatgattgtaaccttgataaa |
118 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10562982 |
aatacaaagaatatatcttatgctgtatacatatgctaaaattaattattctcagagagattaactgtatataatttgacatgattgtaaccttgataaa |
10563081 |
T |
 |
| Q |
119 |
tccatgtcgcaacgcaaggtagtcatattttgcaactgagccataaaattgtttgaagaatgatctctgccaacacaaacacaaactgaaggtgagtaca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10563082 |
tccatgtcgcaacgcaaggtagtcatattttgcaactgagccataaaattgtttgaagaatgatctctggcaacacaaacacaaactgaaggtgagtaca |
10563181 |
T |
 |
| Q |
219 |
tcatcataaaaacaattttacaagtataaattttg |
253 |
Q |
| |
|
| |||| |||||| || | ||||||||||| |||| |
|
|
| T |
10563182 |
taatcagaaaaaccatctcacaagtataaaatttg |
10563216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University