View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_high_19 (Length: 250)
Name: NF10478_high_19
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 52445161 - 52444936
Alignment:
| Q |
13 |
ttatctcacaagaatgatgtggtcaaaatatatgatcgacaactagatagatttggtgtacatttgttggaggaaaaatgtcacaatgagacaaaataaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
52445161 |
ttatctcacaagaatgatgtggtcaaaatatatgatcgacaactagatagatttggtgtacatttgttggatgaaaaatgttacaatgagacaaaataaa |
52445062 |
T |
|
| Q |
113 |
gttattgacaattctgtataaccgtacgtaccgttgtgggagctggcttaagagaaattcttgcccttgttataactccaaattgtcctaaacctccaag |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52445061 |
gttattgacaattctgtataacc----gtaccgttgtgggagctggcttaagagaaattcttgcccttgttataactccaaattgtcctaaacctccaag |
52444966 |
T |
|
| Q |
213 |
aaccgcgtgatataactctgaattcttctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52444965 |
aaccgcgtgatataactctgaattcttctc |
52444936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 154 - 215
Target Start/End: Complemental strand, 17277293 - 17277232
Alignment:
| Q |
154 |
gctggcttaagagaaattcttgcccttgttataactccaaattgtcctaaacctccaagaac |
215 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
17277293 |
gctggctcaagagctattcttgcccttgttataattccaaattgtcctaatcctccaagaac |
17277232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University