View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_high_20 (Length: 250)
Name: NF10478_high_20
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 67 - 239
Target Start/End: Complemental strand, 3450863 - 3450689
Alignment:
| Q |
67 |
tgtttaaatttttatcggaactaaattgagtctcgcagtttgtctcggtgacaaaaagtctaaaatgggtctgcact--taaaaaattgcagctttaatg |
164 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
3450863 |
tgtttaaatttttgtgggaactaaattgagtctcgcagtttgtctcagtgacaaaaagtttaaaatgggtccgcactcttaaaaaattgcagctttaatg |
3450764 |
T |
|
| Q |
165 |
ctttaccttcataggattggtagagtttggtgcttttcctttggaagaagaagcttttcttttccttgaattcat |
239 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3450763 |
ctttaccttcgtaggattggtagagtttggtgcttttcctttggaagaagaagcttttcttttccttgaattcat |
3450689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University