View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_high_23 (Length: 239)
Name: NF10478_high_23
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 22798403 - 22798625
Alignment:
| Q |
1 |
caagtcagtcttaactgtgttcttttctagaagtatacttttggagggaaaaacaaccgtgtctgtaccgaaagtatacttctgaagtgattgtggaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22798403 |
caagtcagtcttaactgtgttcttttctagaagtatacttttggagggaaaaacaaccgtgtctgtaccggaagtatacttctgaagtgattgtggaggg |
22798502 |
T |
 |
| Q |
101 |
aaagaaaagaagctcgtttatgttatcccttgcttctagataattcaaacatgctggttcacttttgacaatttctacaggtgcatagagcttgcacaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22798503 |
aaagaaaagaagctcgtttatgttatcccttgcttctagataattcaaacatgttggttcacttttgaaaatttctacaggtgcatagagcttgcacaga |
22798602 |
T |
 |
| Q |
201 |
gagagaaatccttgacatgttgg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22798603 |
gagagaaatccttgacatgttgg |
22798625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 172 - 223
Target Start/End: Original strand, 40962700 - 40962751
Alignment:
| Q |
172 |
tttctacaggtgcatagagcttgcacagagagagaaatccttgacatgttgg |
223 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
40962700 |
tttccacaggtgcatagagcttgcactgaaagagaaatccttgacatgttgg |
40962751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University