View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_high_6 (Length: 408)
Name: NF10478_high_6
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 382; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 1 - 390
Target Start/End: Complemental strand, 5445551 - 5445162
Alignment:
| Q |
1 |
agcattgttcacttcatgacccaaataagtttcagcaacttcctttaacttagacaacaccatggaagatatctcttgaggtgaaaaatgtttctcttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445551 |
agcattgttcacttcatgacccaaataagtttcagcaacttcctttaacttagacaacaccatggaagatatctcttgaggtgaaaaatgtttctcttgg |
5445452 |
T |
|
| Q |
101 |
cctttgtaattgacaacaatcatgggtttgtctttgtggttcggaacaactttaaaaggccaaagctttatgtcttgttggactgtttggtcagagaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445451 |
cctttgtaattgacaacaatcatgggtttgtctttgtggttcggaacaactttaaaaggccaaagctttatgtcttgttggactgtttggtcagagaatc |
5445352 |
T |
|
| Q |
201 |
gacggccaatcagacgtttggcatcaaaaacagtgttgtggggatttttggctaattggtttttggcagcatcgcctattaatctttcagtgtcggtgaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5445351 |
gacggccaatcagacgtttggcatcaaaaacagtgttgtggggatatttggctaattggtttttggcagcatcgcctattaatctttcagtgtcagtgaa |
5445252 |
T |
|
| Q |
301 |
ggcaacgtaagaaggggtgacacggttcccttggtcgtttggaatgatctcaacacgattgtttcgccacactgcaatgcagctgtagct |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445251 |
ggcaacgtaagaaggggtgacacggttcccttggtcgtttggaatgatctcaacacgattgtttcgccacactgcaatgcagctgtagct |
5445162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 330 - 388
Target Start/End: Original strand, 5440993 - 5441051
Alignment:
| Q |
330 |
cttggtcgtttggaatgatctcaacacgattgtttcgccacactgcaatgcagctgtag |
388 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | ||||| || ||||||||||||| |
|
|
| T |
5440993 |
cttggtcgtttggaatgatctcaacatgattgtgttgccactctcaaatgcagctgtag |
5441051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University