View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_low_14 (Length: 326)
Name: NF10478_low_14
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 15 - 316
Target Start/End: Complemental strand, 35309021 - 35308720
Alignment:
| Q |
15 |
aatatgatggaagtttgtggcacttgtctgtcttgttgcgccgtttgctgtccaatttaattttccattttctataagctggctaagttgcctaatctag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35309021 |
aatatgatggaagtttgtggcacttgtctgtcttgttgcgccgtttgctgtccaatttaattttccattttctataagctggctaagttgcctaatctag |
35308922 |
T |
|
| Q |
115 |
tagactgaaattcaatatcactatttttgtgtgaccaacttcatgcaattgaggtatattagtcatatcgcaaaataatggattttcattctagtacttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35308921 |
tagactgaaattcaatatcactatttttgtgtgaccaacttcatgcaattgaggtatattagtcatatcgcaaaataatggattttcattctagtacttt |
35308822 |
T |
|
| Q |
215 |
ctcctctaagttaagggacaaagggaattggtattacaggtagatggtctgactatatgtgtgttttgatggttaatattgacaggatctagttgacctt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35308821 |
ctcctctaagttaagggacaaagggaattggtattacaggtagatggtctgactatatgtgtgttttgatggttaatattgacaggatctagttgacctt |
35308722 |
T |
|
| Q |
315 |
tg |
316 |
Q |
| |
|
|| |
|
|
| T |
35308721 |
tg |
35308720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University