View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_low_21 (Length: 256)
Name: NF10478_low_21
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 65 - 241
Target Start/End: Complemental strand, 52445330 - 52445158
Alignment:
| Q |
65 |
aaaaaatcaatgattcatactcatacgtatatattaactcatccaaatattcatttgtgaatatgtgcctttcattgatgactaatggagcagtgcaaag |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52445330 |
aaaaaatcaatgattcatactcatacgtatatattaactcatccaaatattcatttgtgaatatgtgcctttcattgatgactaatggaacagtgcaaag |
52445231 |
T |
 |
| Q |
165 |
tgaaatatatatatgacgcgtaactaccaagaatgttaacaatactagtggattacggacaaggacatgttgcttat |
241 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52445230 |
tgaaat----atatgacgcgtaactaccaagaatgttaacaatactagtggattacggacaaggacatgttgcttat |
52445158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University