View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_low_31 (Length: 238)
Name: NF10478_low_31
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 40568419 - 40568624
Alignment:
| Q |
14 |
catagggggaggggagggaacacatactt----tgatgataaggttatatcagaattgtgcaaaccttgcaatgatgctatcatcatcataatacttcta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
40568419 |
catagggggaggggagggaacacatacttaatttgatgataaggttatatcagaattgtgcaaaccttgcaatgatgctatgatcat---aatatttcta |
40568515 |
T |
|
| Q |
110 |
ggtaaattcattggttatgttacgacgagggagcatgtcaaggcgttatggaaactaactggtggttttgagattgtagatattggccatggatttttca |
209 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40568516 |
ggtaaattcattggttatgttacgacg--ggagcatgtcaaggcgttatggaaactaactggtggttttgagattgtagatattggccatggatttttca |
40568613 |
T |
|
| Q |
210 |
tggtacagttc |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
40568614 |
tggtacagttc |
40568624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University