View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_low_34 (Length: 229)
Name: NF10478_low_34
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_low_34 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 10562773 - 10563003
Alignment:
| Q |
1 |
ggtaccaactatggtatgtataacaatcaaaaatagttaacatttcttgcattaaacaaa-catagataaacatgttt-gagaattgagactttgaaccc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10562773 |
ggtaccaactatggtatgtataacaatcaagaaaagttaacgtttcttgcattaaacaaaacatagataaacatgttttgagaattgagactttgaaccc |
10562872 |
T |
 |
| Q |
99 |
tcaccttatgcctataacttttctgaagtcaacttcaagcgtccttgtgatgtagctatgaaaattaaaattgggatcgttcgggtagtgttcctggaaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10562873 |
tcaccttatgcctataacttttctgaagtcaacttcaagtgtcctcgtgatgtagctatgaaaattaaaattgggatcgttcgggtagtgttcctggtaa |
10562972 |
T |
 |
| Q |
199 |
aaaggtcacaatacaaagaatatatcttatg |
229 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
10562973 |
aaaggttacaatacaaagaatatatcttatg |
10563003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University