View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10478_low_5 (Length: 432)
Name: NF10478_low_5
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10478_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 18 - 335
Target Start/End: Complemental strand, 48961030 - 48960713
Alignment:
| Q |
18 |
gtgaattagtggatctggcatttggcgaatgcattgggctacgaacgttttgtttaatagtttttggagattgagtgggaattggaacacgagaagtgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961030 |
gtgaattagtggatctggcatttggcgaatgcattgggctacgaacgttttgtttaatagtttttggagattgagtgggaattggaacacgagaagtgtt |
48960931 |
T |
|
| Q |
118 |
ggctgtagttttctctggggaagaactacttgaatattgtgttgtcttttgaataggagaagatggcatcgaagaagatgaagaagaattaggaaacaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48960930 |
ggctgtagttttctctggggaagaactacttgaatattgtgttgtcttttgaataggagaagatggcatcgaagaagatgaagaagaattgggaaacaag |
48960831 |
T |
|
| Q |
218 |
cccctatgaggtggagatgaaaatgtttgttctgttttcttttcttgaggttgagtctgattatgaggtgatgggggtgctgaagcagtcctaaatgtgg |
317 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48960830 |
cccctatgaggtggagatgaaagtgtttgttctgttttcttttcttgaggttgagtttgattatgaggtgatgggggtgctgaagcagtcctaaatgtgg |
48960731 |
T |
|
| Q |
318 |
gtagagacatagtagggc |
335 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48960730 |
gtagagacatagtagggc |
48960713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University