View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10480_low_4 (Length: 339)
Name: NF10480_low_4
Description: NF10480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10480_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 48 - 338
Target Start/End: Original strand, 32194578 - 32194868
Alignment:
| Q |
48 |
tccccttccaccgccgtcatagttgaaggaatccacatagagtatgctggtgttaaacggcatgcactatcatgcacacatgctcccataccaactccat |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32194578 |
tccccttccaccgccgtcatagttgaaggaatccacatagagtttgctggtgttaaacggcctgcactatcatgcacacatgctcccataccaactccgt |
32194677 |
T |
 |
| Q |
148 |
tttgggcagaaactatagcaacatctgagttgcattggacataaccgtgagacagaggcaaccagttcatatggttctagtttttactatctggccgtgc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32194678 |
tttgggcagaaactatagcaacatctgagttgcattggacataaccgtgagacagaggcaaccagttcatatggttctagtttttactatctggccgtgc |
32194777 |
T |
 |
| Q |
248 |
atgcttcaaggcatgccaaacagctgctacctgagccaaaacctgtgagcagttctccgaaaaaccctctcaaggctctctgctcctcctc |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
32194778 |
atgcttcaaggcatgccaaacagctgctaccagagccaaaacctgtgagcagttctccgaaaaaccctctcaaggctctttgttcctcctc |
32194868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University