View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10480_low_8 (Length: 251)
Name: NF10480_low_8
Description: NF10480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10480_low_8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 92 - 251
Target Start/End: Complemental strand, 4572092 - 4571939
Alignment:
| Q |
92 |
tcatcactcactcttggttatgctaaagattcatcatttcttaagctctcatcaatgcaagtgatggaaaaagatgcatcacaatcacaaccttgttgca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4572092 |
tcatcactcactcttggttatgctaaagattcatcatttcttaagctctcatcaatgcaagtgatgga------tccatcacaatcacaaccttgttgca |
4571999 |
T |
 |
| Q |
192 |
caaacttgcaggatggtgagaaaaatgcattctcaccttcttctgcaagaaattcagctt |
251 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4571998 |
caaacttgcaagatggtgagaaaaatacattctcaccttcttctgcaagaaattcagctt |
4571939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University