View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_high_23 (Length: 222)
Name: NF10481A_high_23
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_high_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 103 - 222
Target Start/End: Complemental strand, 42821873 - 42821754
Alignment:
| Q |
103 |
atgaattggacagtgaccatagtcccttcttctctaccccatttatactctttggtttgcttgttaaggctgcaacttttcacgttggatgcaactagtt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42821873 |
atgaattggacagtgaccatagtcccttcttctctaccccatttatactctttggtttgcttgttaaagctgcaacttttcacgttggatgcaactagtt |
42821774 |
T |
 |
| Q |
203 |
gaagtcaacacagtcaccat |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42821773 |
gaagtcaacacagtcaccat |
42821754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 22 - 96
Target Start/End: Original strand, 37179999 - 37180073
Alignment:
| Q |
22 |
gaagtgactgctggcaatggtggaatgttgagagatggaattgttggaatatttgtaggaagacttggaagtggt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37179999 |
gaagtgactgctggcaatggtggaatgttgagagatggaattgttggaatatttgtaggaagacttggaagtggt |
37180073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 22 - 96
Target Start/End: Complemental strand, 37181738 - 37181664
Alignment:
| Q |
22 |
gaagtgactgctggcaatggtggaatgttgagagatggaattgttggaatatttgtaggaagacttggaagtggt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37181738 |
gaagtgactgctggcaatggtggaatgttgagagatggaattgttggaatatttgtaggaagacttggaagtggt |
37181664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 22 - 96
Target Start/End: Complemental strand, 37189855 - 37189781
Alignment:
| Q |
22 |
gaagtgactgctggcaatggtggaatgttgagagatggaattgttggaatatttgtaggaagacttggaagtggt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37189855 |
gaagtgactgctggcaatggtggaatgttgagagatggaattgttggaatatttgtaggaagacttggaagtggt |
37189781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 22 - 96
Target Start/End: Original strand, 37187682 - 37187756
Alignment:
| Q |
22 |
gaagtgactgctggcaatggtggaatgttgagagatggaattgttggaatatttgtaggaagacttggaagtggt |
96 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
37187682 |
gaagtggctgctggcaatggtggaatgttgagagatggaattgttggaaaatttgtaggaaagctaggaagtggt |
37187756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University