View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_107 (Length: 363)
Name: NF10481A_low_107
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_107 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0082 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 2 - 348
Target Start/End: Complemental strand, 52246 - 51900
Alignment:
| Q |
2 |
caaagaaggccttctaaggcggactctggctctttcatttgtaagagtcctcctcaggcacgagattgtccgatgaaggagaaacttgctggttgccgag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52246 |
caaagaaggccttctaaggcggactctggctctttcatttgtaagagtcctcctcaggcacgagattgtccgatgaaggagaaacttgctggttgccgag |
52147 |
T |
|
| Q |
102 |
gacaagagggaagaacccctagggtgaatccgttacagttgcggaatgcgatcacccattagaagcctacgtctgctgggcttatgtatgttgagatagt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52146 |
gacaagagggaagaacccctagggtgaatccgttacagttgcggaatgcgatcacccattagaagcctacgtctgctgggcttatgtatgttgagatagt |
52047 |
T |
|
| Q |
202 |
gctgaatgaaatggccactctgctcgtgcgatggtcgataccggcgccacgagacgaggctacttccatccaaccaagggaaaagtgaagtcccggtaag |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52046 |
gctgaatgaaatggccactctgctcgtgcgatggtcgataccggcgccacgagacgaggctacttccatccaaccaagggaaaagtgaagtcccggtaag |
51947 |
T |
|
| Q |
302 |
caagccatgatcatgatcagagggagaagactattcattcatcgtca |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51946 |
caagccatgatcatgatcagagggagaagactattcattcatcgtca |
51900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University