View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_117 (Length: 355)
Name: NF10481A_low_117
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_117 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 2 - 238
Target Start/End: Complemental strand, 56487750 - 56487502
Alignment:
| Q |
2 |
atgaagggaatgaatgaaaagagttcacttactagagccatattagggtcgatctggactgaacctgcttattgctgcgaataataatcaaaatcaga-- |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
56487750 |
atgaagggaatgaatgaaaagagttcacttaccagagccatattagggtcgatctggactgaacctgcttattgctgcgaataataatcaaaatcaaaat |
56487651 |
T |
|
| Q |
100 |
----------gataacgataatgaaaactgaaaagaaaccaaatctgccaagagatttcacttacagaggcagttagtttgagcggcggagtgatttagg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56487650 |
caaaatcaaagataacgataatgaaaactgaaaagaaaccaaatctgccaagagattttacttacagaggcagttagtttgagcggcggagtgatttagg |
56487551 |
T |
|
| Q |
190 |
gtttcagttcctctcactgctatgcgatttactagtactagtatattcc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56487550 |
gtttcagttcctctcactgctatgcgatttactagtactagtatattcc |
56487502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University