View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_118 (Length: 355)
Name: NF10481A_low_118
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_118 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 9 - 340
Target Start/End: Complemental strand, 14126837 - 14126506
Alignment:
| Q |
9 |
aataagagggaatagattatagtgccaactttatcagtacctctcatcctgcttacgagagacagtagctgctccatgaattaattttgttccaaatccg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14126837 |
aataagagggaatagattatagtgccaactttatcggtacctctcatcctgcttacgagagacagtagctgctccatgaattaattttgttccaaatccg |
14126738 |
T |
 |
| Q |
109 |
atcttttctgccgcagaatgtctctgacttttgaaaattaatagcttgaccagatgtcgcttcgtatgaggctaggatatttttcatgacattttcttca |
208 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14126737 |
atcttttctgctgcagaatgtctctgacttttgaaaattaatagcttgaccagatgtcgcttcgtatgaggctaggatatttttcatgacattttcttca |
14126638 |
T |
 |
| Q |
209 |
ctagcagagcttttgaagaacaaaaaacagtcatcagcaaggagtaggtgagataatcgatgcattggtgcgaatcctaataccatgcagaattccttgc |
308 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14126637 |
ctagcagagcctttgaagaacaaaaaacagtcatcagcaaagagtaggtgagaaaatcggtgcattggtgtgaatcctaataccatgcagaattccttgc |
14126538 |
T |
 |
| Q |
309 |
ccttataatcggtgcattgtcttcttctgatg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14126537 |
ccttataatcggtgcattgtcttcttctgatg |
14126506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University