View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_120 (Length: 354)
Name: NF10481A_low_120
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_120 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 277
Target Start/End: Original strand, 44734256 - 44734521
Alignment:
| Q |
10 |
actaagttagttaaaacacttgaaaattcaactgacac--aacaaggttaatttggttctctttcttttggtttttgtttgtgttcaaggtactgttgtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44734256 |
actaagttagttaaaacacttgaaaactcaactgacacacaacaaggttaatttggttctctttcttttggtttttgtttgtgttcaaggttctgttgtt |
44734355 |
T |
 |
| Q |
108 |
gtcgcgggaatgccactgctatttaaagccatcacaaacgacttaaggacccttttcacacnnnnnnnnnnnnggactaatgagtaatgaatgaccccac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
44734356 |
gtcgcgggaatgccactgctatttaaagtcatcacaaacgacttaaggacccttttcacacaaaaacaaaaaaggactaatgagt----aatgaccccac |
44734451 |
T |
 |
| Q |
208 |
ctagcatattctttctttctatccttttaacacatttacattgagagggatctattttattcctaaatgg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44734452 |
ctagcatattctttctttctatccttttaacacatttacattgagagggatctattttattcctaaatgg |
44734521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University