View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_135 (Length: 347)
Name: NF10481A_low_135
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_135 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 122 - 347
Target Start/End: Complemental strand, 17551798 - 17551573
Alignment:
| Q |
122 |
catccatccatcccttgtgctgtttaggtatggcagggattgatgttgcaaagtttggtcatagtcctgttcataagtctgtgattttgaaggattatgg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17551798 |
catccatccatcccttgtgctgtttaggtatggcagggattgatgttgcaaagtttggtcatagtcctgttcataaggctgtgattttgaaggattatgg |
17551699 |
T |
|
| Q |
222 |
tgagcttaagaggatacttgggggtttacctaagctgtgtaatgtgggtgagattcgtacggaagcagtttcaattttagaggaagagaaagctgatgca |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
17551698 |
tgagcttaagaggatacttgggggtttacctaagctgtgtaatgtgggtgagattcgtacggaagcggtttcaattttagaggaagagaaggctgatgca |
17551599 |
T |
|
| Q |
322 |
atctctgctgtgattgataggcgtga |
347 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
17551598 |
atctctgctgtgattgataggcgtga |
17551573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 9 - 47
Target Start/End: Complemental strand, 17551912 - 17551874
Alignment:
| Q |
9 |
gattattctgcaagtttgtggtgaccctattggataaag |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17551912 |
gattattctgcaagtttgtggtgaccctattggataaag |
17551874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University