View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_148 (Length: 339)
Name: NF10481A_low_148
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_148 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 9 - 339
Target Start/End: Complemental strand, 9524510 - 9524180
Alignment:
| Q |
9 |
gataatactgaactgcatttagaagaaaagaagaggaatgaaatatttttgaaggacggaataccaacctggattgcagcctctggatatgtgggtttgg |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9524510 |
gataattctgaactgcatttagaagaaaagaagaggaatgaaatatttttgaaggacgggataccgacctggattgcagcctctggatatgtgggtttgg |
9524411 |
T |
|
| Q |
109 |
cagcgatatccatcacagtaataccaattattttccctcctctcaaatggtacttggttctgggctcttacatccttgcccctgccttagccttttgcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9524410 |
cagcgatatccatcacagtaataccaattattttccctcctctcaaatggtacttggttctgggctcttacatccttgcccctgccttagccttttgcaa |
9524311 |
T |
|
| Q |
209 |
ctcatacggcacagggctcacagactggagtttggcatccacgtacggtaaaatcggtcttttcatcattgcggcagcagttggcacaaacggtggtgta |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9524310 |
ctcatacggcacagggctcacagactggagtttggcatccacgtacggtaaaatcggtcttttcatcattgcggcagcagttggcacaaacggtggtgta |
9524211 |
T |
|
| Q |
309 |
attgccggtgtagcatcctgtgctgtcatga |
339 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
9524210 |
attgccggtgtagcatcttgtgctgtcatga |
9524180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University