View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_151 (Length: 338)
Name: NF10481A_low_151
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_151 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 5188280 - 5188609
Alignment:
| Q |
1 |
aatatcttagagggagaccaacccattcgataacttcactattatttttctttcttcttccnnnnnnnnnnctccactattattgttggcatctactatt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5188280 |
aatatcttagagggagaccaacc-attcgataacttcactattatttttctttcttcttccaaaaaaaaaactccactattattgttggcatctactatt |
5188378 |
T |
 |
| Q |
101 |
tgctaaaagaatatactatatggcatatgcaaggcaacgtacttcagcatgcttatttttatgagaattaagtattccaagtcaattaatattatgtcat |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5188379 |
tgctaaaaggatatactatatggcatatgcaaggcaacgtacttcagcatgcttatttttatgagaattaagtattccaagtcaattaatattatgtcat |
5188478 |
T |
 |
| Q |
201 |
cggaatattccttgtaccnnnnnnnnncgtagctgtcattttgatgaataaaataattcatatatactgtataggaagggatttggaatctgcatcaaac |
300 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5188479 |
cggaatattccttgtacctttttttttcgtagctgtcattttgatgaataaaataattcatatatactgtata-gaagggatttggaatctgcatcaaac |
5188577 |
T |
 |
| Q |
301 |
ccttgcgtcgttgtgttgcatgatgaatgaaa |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5188578 |
ccttgcgtcgttgtgttgcatgatgaatgaaa |
5188609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University