View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_153 (Length: 335)
Name: NF10481A_low_153
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_153 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 6 - 335
Target Start/End: Complemental strand, 52199773 - 52199444
Alignment:
| Q |
6 |
gtttggaggtcacaggacagcatggctgaaatctgaagttgcagtggttggtgggagtggtaagtacgggaatgcaaggggatatgcagctcttgagaca |
105 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52199773 |
gtttggagttcacaggacagcatcgctgaaatctgaagttgcagtgattggtgggagtggtaagtacgagaatgcaaggggatatgcagctcttgagaca |
52199674 |
T |
|
| Q |
106 |
ctgctgaaagaggatcagcacaccacggatggagtcgacaccatcatccatttcaatatctaccttactcactaatatgaatatctactttcattctcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52199673 |
ctgctgaaagaggatcagcacaccacggatggagtcgacaccatcatccatttcgatatctaccttactcactaatatgaatatctactttcattctcat |
52199574 |
T |
|
| Q |
206 |
tggctttcatgccattttgcatttgatgttttgaattctgcatgcccactggttaagatagataaaaatgagttatatttccacaccctttttcatgcaa |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52199573 |
tggctttcatgccattttgcatttgatgttttgaattctgcatgcccactggttaagatagataaaaatgagttatatttccacaccctttttcatgcaa |
52199474 |
T |
|
| Q |
306 |
cacgtttttagaattttggttttcttttga |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52199473 |
cacgtttttagaattttggttttcttttga |
52199444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University