View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_164 (Length: 328)
Name: NF10481A_low_164
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_164 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 10 - 318
Target Start/End: Original strand, 7144006 - 7144314
Alignment:
| Q |
10 |
atgatctgggccttgaaaaggaacgtaagacaaaaagtcttcctgcttccaacattttgaccgaggaggtaaacactgaattggtgaatggcgacatatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7144006 |
atgatctgggccttgaaaaggaacgtaagacaaaaagtcttcctgcttccaacattttgaccgaggaggtaaacactgaattggtgaatggcgacatatt |
7144105 |
T |
|
| Q |
110 |
taggatagataactaccctgtcctaagaggggctagacaaaatcacattagaagtgattggtacaacatgcttttagagtattttcagtcaaggcaagca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7144106 |
taggatagataactaccctgtcctaagaggggctagacaaaatcacattagaagtgattggtacaacatgcttttagagtattttcagtcaaggcaagca |
7144205 |
T |
|
| Q |
210 |
gaagatacaggattcttttatgccatggaagttgataatggtaattgcatgagcatattttgggctgacggaagatctagatactcatgtagtcagtttg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7144206 |
gaagatacaggattcttttatgccatggaagttgataatggtaattgcatgagcatattttgggctgacggaagatctagatactcatgtagtcagtttg |
7144305 |
T |
|
| Q |
310 |
gtgatgtcc |
318 |
Q |
| |
|
| ||||||| |
|
|
| T |
7144306 |
gcgatgtcc |
7144314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University