View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_172 (Length: 322)
Name: NF10481A_low_172
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_172 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 23 - 285
Target Start/End: Complemental strand, 52002264 - 52002002
Alignment:
| Q |
23 |
ccctcccattgaggatataacttctatcacagaacaactaaagggccacggtttttccaacaaagaaattggtgcaatccttaccttatccccatcaaca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52002264 |
ccctcccattgaggatataacttctatcacagaacaactaaagggccacggtttttccaacaaagaaattggtgcaatccttaccttagccccatcaaca |
52002165 |
T |
|
| Q |
123 |
tatgttcctgaatctcccaatcatattcatagagatgaaagaccacatgaaccctttctcaagagaggaactgaacccgactccgatgatgcctcttctt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52002164 |
tatgttcctgaatctcccaatcatattcatagagatgaaagaccacatgaaccctttctcaagagaggaacggaacccgactccgatgatgcctcttctt |
52002065 |
T |
|
| Q |
223 |
ctaaacgcacaaaactctacaactttgaaaacacttccgatccaaaaggaaagaaaccactca |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52002064 |
ctaaacgcacaaaactctacaactttgaaaacacttctgatccaaaaggaaagaaaccactca |
52002002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 44 - 95
Target Start/End: Complemental strand, 52012216 - 52012165
Alignment:
| Q |
44 |
ttctatcacagaacaactaaagggccacggtttttccaacaaagaaattggt |
95 |
Q |
| |
|
|||| ||||| ||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
52012216 |
ttctgtcacaaaacaactcaagggtcacggtttttccgacaaagaaattggt |
52012165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University