View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_175 (Length: 319)
Name: NF10481A_low_175
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_175 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 5 - 319
Target Start/End: Complemental strand, 12122859 - 12122545
Alignment:
| Q |
5 |
agtttggtgttattggttttatggattctgtctaaagtaatcttcattatgtccctctattttgatagtctgtcctctatctcacgtgtttcccctctcc |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122859 |
agttcggtgttattggttttatggattctgtctaaagtaatcttcattatgtctctctattttgatagtctgtcctctatctcacgtgtttcccctctcc |
12122760 |
T |
|
| Q |
105 |
cagcttatcattttctggtttttctcttcccttttcatataattcttgatttcatatgtttaatagcttttttgacaatttttattgttatttgtgttca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122759 |
cagcttatcattttctggtttttctcttcccttttcatataattcttgatttcatatgtttaatagcttttttgacaatttttattgttatttgtgttca |
12122660 |
T |
|
| Q |
205 |
atagatacagcttcagtagcaaaatggtgaagctgagaatcccggagcatcaagttgccggtcaccaagcaaaaactggactcctaggtccactgataga |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12122659 |
atagatacagcttcagtagcaaaatggtgaagctgaaaatcccggagcatcaagttgccggtcaccaagcaaaaactggaatcctaggtccactgataga |
12122560 |
T |
|
| Q |
305 |
cgattctggaaaatt |
319 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12122559 |
cgattctggaaaatt |
12122545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 173 - 316
Target Start/End: Complemental strand, 14692210 - 14692067
Alignment:
| Q |
173 |
tttttgacaatttttattgttatttgtgttcaatagatacagcttcagtagcaaaatggtgaagctgagaatcccggagcatcaagttgccggtcaccaa |
272 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||| ||||| |||||||| ||||||||| |
|
|
| T |
14692210 |
tttttgacaatttttgttgttatttgtgttcaatggatacagcttcagtaacaaaatggtgaagctgaaaatcccagagcaccaagttgcaggtcaccaa |
14692111 |
T |
|
| Q |
273 |
gcaaaaactggactcctaggtccactgatagacgattctggaaa |
316 |
Q |
| |
|
||||||| ||| |||||||||| || ||||||||||||||||| |
|
|
| T |
14692110 |
gcaaaaaacggaatcctaggtcctctaatagacgattctggaaa |
14692067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University