View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_184 (Length: 315)
Name: NF10481A_low_184
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_184 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 194 - 295
Target Start/End: Complemental strand, 24524519 - 24524418
Alignment:
| Q |
194 |
gctagtcctaggggatttgtttgtttctctatggtagccgtttggttttgagcaacgtgtgtgcgctccaactctgtatgtttcacttgtcgtgtagcat |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
24524519 |
gctagtcctaggggatttgtttgtttctctatggtagccgtttggttttgagcaacgtgtgtgcgctccaactttgtatgtttctcttgtcgtgtagcat |
24524420 |
T |
|
| Q |
294 |
at |
295 |
Q |
| |
|
|| |
|
|
| T |
24524419 |
at |
24524418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 24524588 - 24524526
Alignment:
| Q |
1 |
ttttgggggctgttggaagtggttgctgctttctgtccgctgaattgttggtgctgttctgct |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24524588 |
ttttgggggctgttggaagtggttgctgctttctgtcggctgaattgttggtgctgttctgct |
24524526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 9122639 - 9122575
Alignment:
| Q |
1 |
ttttgggggctgttggaagtggttgctgctttctgtccgctgaattgttggtgctgttctgctgc |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9122639 |
ttttgggggctgttggaagtggttgctgctttctgtcggctgaattgttggtgctgttctgctgc |
9122575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 9130735 - 9130671
Alignment:
| Q |
1 |
ttttgggggctgttggaagtggttgctgctttctgtccgctgaattgttggtgctgttctgctgc |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9130735 |
ttttgggggctgttggaagtggttgctgctttctgtcggctgaattgttggtgctgttctgctgc |
9130671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University