View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_189 (Length: 314)
Name: NF10481A_low_189
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_189 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 17 - 314
Target Start/End: Original strand, 1329786 - 1330083
Alignment:
| Q |
17 |
caaacttgccttagctttatttgatggggctgcaccagcaacaagtgaaggtggaataaaagcacttccatggcatgcatttgacgagagtgcagattgg |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1329786 |
caaactagccttagctttatttgatggggctgcaccagcaacaagtgaaggtggaataaaagcacttccatggcatgcatttgatgagagtgcagattgg |
1329885 |
T |
|
| Q |
117 |
gaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatggtatgtataaacaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329886 |
gaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatggtatgtataaacaag |
1329985 |
T |
|
| Q |
217 |
gagaaatgaatgcagccatgcaaggagtgggatatggttgcagtggaagtgctagcagtgtagcacttggttcagccggaaggccagcaatgctagca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329986 |
gagaaatgaatgcagccatgcaaggagtgggatatggtggcagtggaagtgctagcagtgtagcacttggttcagccggaaggccagcaatgctagca |
1330083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University