View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_198 (Length: 310)
Name: NF10481A_low_198
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_198 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 20132638 - 20132757
Alignment:
| Q |
1 |
ttattgaaacttcacaaacttttgcgttttgacttcgtttatgacttctttcattcaatcattttgtagtcatttataaatgaccacaagattggtactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20132638 |
ttattgaaacttcacaaacttttgcgttttgacttcgtttatgacttctttcattcaatcattttgtagtcatttataaatgaccacaagattggtactt |
20132737 |
T |
|
| Q |
101 |
aatacactttcgtacaactt |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20132738 |
aatacactttcgtacaactt |
20132757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 116 - 234
Target Start/End: Complemental strand, 20132494 - 20132376
Alignment:
| Q |
116 |
aacttcaaaatatatcattacgttttatatcatcattgtagcaatatgcaatgcagaaaagtgatatttcaaaaacttttcatgtaaggtttttgacatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20132494 |
aacttcaaaatatatcattacgttttatatcatctttgtagtaatatgcaatgcagaaaagtgatatttcaaaaacttttcatgtaaggtttttgacatc |
20132395 |
T |
|
| Q |
216 |
acatacgcaacacaattcg |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
20132394 |
acatacgcaacacaattcg |
20132376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University