View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_234 (Length: 289)
Name: NF10481A_low_234
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_234 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 10 - 283
Target Start/End: Complemental strand, 53676061 - 53675788
Alignment:
| Q |
10 |
aaatgaaggttgggcaggcagaagaactcgggcgtccataagtctatcccttttggcagcagaagaagaccttagaattctattataatttcttcnnnnn |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676061 |
aaatgaaggttgggcagacagaagaactcgggcgtccataaatctatcccttttggcagcagaagaagaccttagaattctattataatttcttcaaaaa |
53675962 |
T |
|
| Q |
110 |
nnnnnnngaattctattataattggttgacttttacatgcatatattgttgtggataatggtccactggtctgaggtttacagggctggtgtctttcctt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675961 |
agaaaaagaattctattataattggttgacttttacatgcatatattgttgtggataatggtccactggtctgaggtttacagggctggtgtctttcctt |
53675862 |
T |
|
| Q |
210 |
ataaaaagatatagtttcatgtgtcagatccttttggtttgtttaaccaaatctagtatgtacgcacttggtcc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675861 |
ataaaaagatatagtttcatgtgtcagatccttttggtttgtttaaccaaatctagtatgtacgcacttggtcc |
53675788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University