View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_238 (Length: 288)
Name: NF10481A_low_238
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_238 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 14 - 288
Target Start/End: Complemental strand, 16781504 - 16781230
Alignment:
| Q |
14 |
agagaccgaagtagttggcctgggaccaccaggaaccaaaggagcactggaaggccttgacatcatagtcacttgtgcaataggtttttcggttggtctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16781504 |
agagaccgaagtagttggcctgggaccaccaggaaccaaaggagcactggaaggccttgacatcatagtcacttgtgcaataggtttttcggttggtctt |
16781405 |
T |
 |
| Q |
114 |
ggaggtgaagtcttctggatttctgttttaggcacaattgttggttgcgaagcagacgttaaagatgaagatgtatctttacctgtctgttgtgtgacac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16781404 |
ggaggtgaagtcttctggatttctgttttaggcacaattgttggttgtgaagcagacgttaaagatgaagatgtatctttacctgtctgttgtgtgacac |
16781305 |
T |
 |
| Q |
214 |
taaaagatgttttcctgacattaacaggtgagggtaagtttctagaaggactcctcggcgaggatggccctactg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16781304 |
taaaagatgttttcctgacattaacaggtgagggtaagtttctagaaggactcctcggcgaggatggccctactg |
16781230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University