View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_242 (Length: 287)
Name: NF10481A_low_242
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_242 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 17 - 286
Target Start/End: Original strand, 23193147 - 23193416
Alignment:
| Q |
17 |
tgtcacagatacactggccgtttaggacgaagtcgggatcaaggggttgggaccctgaggtcatggttcccttatgtctttcagagacatggaatgcaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193147 |
tgtcacagatacactggccgtttaggacgaagtcgggatcaaggggttgggaccctgaggtcatggttcccttatgtctttcagagacatggaatgcaat |
23193246 |
T |
|
| Q |
117 |
ggaaggtttattcgcctcaggtcaagcacgtgcgattggtgtcagcaacttttcaactaagaagcttcaagacttactcggatatgctaagattccgcca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193247 |
ggaaggtttattcgcctcaggtcaagcacgtgcgattggtgtcagcaacttttcaactaagaagcttcaagacttactcggatatgctaagattccgcca |
23193346 |
T |
|
| Q |
217 |
gcagttaaccaagttgaatgccatcctgtttggcaacaaccagctcttcataatttgtgcaattctactg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193347 |
gcagttaaccaagttgaatgccatcctgtttggcaacaaccagctcttcataatttgtgcaattctactg |
23193416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University