View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_246 (Length: 285)
Name: NF10481A_low_246
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_246 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 20 - 281
Target Start/End: Original strand, 48669392 - 48669653
Alignment:
| Q |
20 |
aagaagatctttggaagaagatttgggaagatgcaacttatgatcttgcatctgttctctcttctcttgctgtctttgttttcactttcactctttactt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669392 |
aagaagatctttggaagaagatttgggaagatgcaacttatgatcttgcatctgttctctcttctcttgctgtctttgttttcactttcactctttactt |
48669491 |
T |
|
| Q |
120 |
catgtcaaggccacgtcctatttatctcattgattttgcatgctatcaacctgatgatgaactcaaggtatgcacacaaaaactttataaatatgcaaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669492 |
catgtcaaggccacgtcctatttatctcattgattttgcatgctatcaacctgatgatgaactcaaggtatgcacacaaaaactttataaatatgcaaat |
48669591 |
T |
|
| Q |
220 |
gcatctattactatttaattaaattaatcaatcaacgcgtggttgatccgagaattatctac |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
48669592 |
gcatctattactatttaattaaattaatcaatcaacgcgtggttgatccaagtgttatctac |
48669653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University