View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_250 (Length: 284)
Name: NF10481A_low_250
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_250 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 102 - 277
Target Start/End: Complemental strand, 41538061 - 41537885
Alignment:
| Q |
102 |
ctatataattaacaaaaa-cagtttttatggaatattagtgtgagtggtacccggtctaacaaaagcaatttctatttttgtcgccagaatttggactgc |
200 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41538061 |
ctatataattaaaaaaaaacagtttttatggaatattagtgtgagtggtacccggtctaacaaaagcaatttctatttttgtcgccagaatttggactgc |
41537962 |
T |
 |
| Q |
201 |
atgtagatttactcgttctcctatggacgtgtttgatttatgttagttagtgcgcgtctctttttgtattcatatca |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
41537961 |
atgtagatttactcgttctcctatggacgtgtttgatttatgttagttagtgcacgtctctttttgtactcatatca |
41537885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University