View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_256 (Length: 283)
Name: NF10481A_low_256
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_256 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 7 - 282
Target Start/End: Complemental strand, 31383487 - 31383219
Alignment:
| Q |
7 |
tttcgtgttggatatagagtttttctaaatggttgatggtttttcgtcgctacatctattgtgcctgcatgtttcaaaattggctcctctgtgcgagagg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31383487 |
tttcgtgttggatatagagtttttctaaatggttgatggtttttcgtcgctacatctattgtgcctgcatgtttcaaaattggctcctctgtgcgagagg |
31383388 |
T |
|
| Q |
107 |
attggatttgtttaggtat-gggtggtgttgccgccttcataccttgttttattgttataattgaagtcatgcctaagtgttgtagattcgttttagggt |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
31383387 |
attggatttgtttaggtatggggtggtgttgccgccttcataccttgttt--------taactgaagtcatgactaggtgttgtagattcgtcttagggt |
31383296 |
T |
|
| Q |
206 |
tgccaatcctaactagcgaggtttttgtttgactttggtggttgaagttttgatagaggttgttgtggagaggtatg |
282 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31383295 |
tgccaatcctaacttgcgaggtttttgtttgactttggtggttgaagttttgattgaggttgttgtggagaggtatg |
31383219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University