View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_270 (Length: 278)
Name: NF10481A_low_270
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_270 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 39 - 278
Target Start/End: Complemental strand, 40586365 - 40586120
Alignment:
| Q |
39 |
ctccctcttgaatgaatcttttactatatttcttccttttccaggagttgaaaaaatgaatggaagtgctttgttctgtttgtagaatttggcacagaaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586365 |
ctccctcttgaatgaatcttttactatatttcttccttttccaggagttgaaaaaatggatggaagtgctttgttctgtttgtagaatttggcacagaaa |
40586266 |
T |
|
| Q |
139 |
aataatacttttgacttagttattttataatgccagttccacttgctccttatccaactccacctccagctcctgctccagc------tccatatacaac |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40586265 |
aataatacttttgacttagttcttttataatgccagttccacttgctccttatccaactccacctccagctcctgctccagctccagctccatatacaac |
40586166 |
T |
|
| Q |
233 |
acctccaacaaatggtatcttaacctttctttttctctgtgcttga |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586165 |
acctccaacaaatggtatcttaacctttctttttctctgtgcttga |
40586120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University