View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_275 (Length: 277)
Name: NF10481A_low_275
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_275 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 5 - 263
Target Start/End: Original strand, 22860863 - 22861122
Alignment:
| Q |
5 |
catcaatgacttcaaa-ttttgaattttccaagagaagctaagggtatttcctttcccctttcttttaaccttagaat-cccataaagtttgagcgaatg |
102 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
22860863 |
catcaatgacttcaaacttttgaattttcca-gagaagctaaaggtatttcctttcccctttcttttaaccttagaaaacccataaagtttaagcgaatg |
22860961 |
T |
|
| Q |
103 |
ttgttccagttccttatctaatagcaagggtgagatggtgagggaattcatataagaaagggatgtaggttttagctttatcgatcctaactcgatctat |
202 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||| ||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22860962 |
ttgttctagttccttatctatgaagaagggtgagagggtgagggaattcgtatcagaaagggatgtaagttttagctttatcgatcctaactcgatctat |
22861061 |
T |
|
| Q |
203 |
ttcatggagttggagaatctttgctcgctccatgttcgctatgagaaatggcacacaggtt |
263 |
Q |
| |
|
||||||||||| | |||||||||||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
22861062 |
ttcatggagtttgggaatctttgctctctccatgttcgttatgagaaatggcacataggtt |
22861122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University