View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_286 (Length: 274)

Name: NF10481A_low_286
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_286
NF10481A_low_286
[»] chr8 (1 HSPs)
chr8 (46-274)||(37978940-37979169)
[»] chr5 (1 HSPs)
chr5 (46-99)||(26143014-26143067)
[»] chr3 (1 HSPs)
chr3 (64-114)||(33493946-33493996)


Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 46 - 274
Target Start/End: Original strand, 37978940 - 37979169
Alignment:
46 cttaccaagtgactctagcaaaaattcgagggccttgcccttgtcccatttaattgcgggacgaatctccaatacctgtattaaacaaattgacattgaa 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
37978940 cttaccaagtgactctagcaaaaattcgagggccttgcccttgtcccatttaattgcgggacgaatctccaatacctgtattaaacaa-ttgacattgaa 37979038  T
146 agtgagacatctcttaagtatttcttattcttaatccctgtcataatcacctttgaactaattaaaccacaccccaccat--aaaaaatatacaccccct 243  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||  ||||||||||||||||||    
37979039 agttagacatctcttaagtatttcttattcttaatccctgtcataatcacctttgaactaattaaatcacaccccaccataaaaaaaatatacaccccct 37979138  T
244 ccaaaaaactgattataaagaaaatagaacc 274  Q
    |||||||||||||||||||||||||||||||    
37979139 ccaaaaaactgattataaagaaaatagaacc 37979169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 26143014 - 26143067
Alignment:
46 cttaccaagtgactctagcaaaaattcgagggccttgcccttgtcccatttaat 99  Q
    ||||||||||||||||||||||||||| || ||| | || ||||||||||||||    
26143014 cttaccaagtgactctagcaaaaattcaagagcccttcctttgtcccatttaat 26143067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 114
Target Start/End: Original strand, 33493946 - 33493996
Alignment:
64 caaaaattcgagggccttgcccttgtcccatttaattgcgggacgaatctc 114  Q
    ||||||||| || |||||||||||||||||||| || | ||||||||||||    
33493946 caaaaattcaagagccttgcccttgtcccatttgatagtgggacgaatctc 33493996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University