View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_303 (Length: 268)
Name: NF10481A_low_303
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_303 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 9 - 193
Target Start/End: Complemental strand, 54074625 - 54074441
Alignment:
| Q |
9 |
gagatgaagagaaaatgcagcaaataaaagaatagaaagtaatgaaagaaggagggttgttcgtggttttcgtcgcatggtttcccaaggactactaatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54074625 |
gagatgaagagaaaatgcagcaaataaaagaatagaaagtaatgaaagaaggagggttgttcgtggttttcgtcgcatggtttcccaaggactactaatg |
54074526 |
T |
 |
| Q |
109 |
aatgtttttgttgaattgttaatggaaatattggaatctgatggtgaagaaggtttcatattcatatgttctatatgagtgaaaa |
193 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54074525 |
aatgttgttgttgaattgttaatggaaatattggaatctgatggtgaagaaggtttcatattcatattttctatatgagtgaaaa |
54074441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University