View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_309 (Length: 266)
Name: NF10481A_low_309
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_309 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 265
Target Start/End: Complemental strand, 38815695 - 38815437
Alignment:
| Q |
10 |
atgatatcggagtctatcctagatctgttgttggactgcccgcattgtccatgcccctagcccaatttatgccaggttgtgaggcag--tgttggaaatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38815695 |
atgatatcggagtctatcctagatctgttgttggactgcccgcattgtccatgcccctagtccaatttatgccaggttgtgaggcagggtgttggaaatt |
38815596 |
T |
|
| Q |
108 |
ttgccttgattgtggtctgcccctagccatcttaaatttggcttttaaatttccttcattgcagcttcgagcaccttaattttgctgggtgtgagaggct |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815595 |
ttgccttgattgtggtcttcccctagccatcttaaatttggcttttaaatttccttcattgcagcttcgagcaccttaattttgctgggtgtgagaggct |
38815496 |
T |
|
| Q |
208 |
gggttagtcctacacagcctagagatctaaatagccgtgaagggcctc-ttgtgtggtg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38815495 |
gggttagtcctacacagcctagagatctaaatagccgtgaagggcctctttgtgtggtg |
38815437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 60
Target Start/End: Original strand, 25971190 - 25971227
Alignment:
| Q |
23 |
ctatcctagatctgttgttggactgcccgcattgtcca |
60 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
25971190 |
ctatcctagatctgttgttggacttcccgcatcgtcca |
25971227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University