View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_310 (Length: 266)
Name: NF10481A_low_310
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_310 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 8 - 261
Target Start/End: Complemental strand, 36458489 - 36458236
Alignment:
| Q |
8 |
tgatatgaagtatatgatcaaattctgcaacttatatggtggtctggaacgtgttgccactaaactcaaggtcagccgggcggtcggaaactctcatcaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458489 |
tgatatgaagtatatgatcaaattctgcaacttatatggtggtctggaacgtgttgccactaaactcaaggtcagccgggcggtcggaaactctcatcaa |
36458390 |
T |
|
| Q |
108 |
gccgcgtcagatagtttgttgacatggcaagcttttaagaagatgaaggacatttattttgtcaacaatggaatcactatgcacgcaggggtgttatttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458389 |
gccgcgtcagatagtttgttgacatggcaagcttttaagaagatgaaggacatttattttgtcaacaatggaatcactatgcacgcaggggtgttatttg |
36458290 |
T |
|
| Q |
208 |
gtttagaagtgacagtttaggattagaaaaagaaaattgtaaaaatatattggt |
261 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458289 |
ggttagaagtgacagtttaggattagaaaaagaaaattgtaaaaatatattggt |
36458236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 167
Target Start/End: Complemental strand, 40874816 - 40874742
Alignment:
| Q |
93 |
ggaaactctcatcaagccgcgtcagatagtttgttgacatggcaagcttttaagaagatgaaggacatttatttt |
167 |
Q |
| |
|
||||| ||||||||||| | ||||||||||||||||| ||||| || |||||||| |||| ||| | ||||||| |
|
|
| T |
40874816 |
ggaaagtctcatcaagctggatcagatagtttgttgacgtggcatgcatttaagaaaatgatggatacttatttt |
40874742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 93 - 153
Target Start/End: Complemental strand, 40871718 - 40871658
Alignment:
| Q |
93 |
ggaaactctcatcaagccgcgtcagatagtttgttgacatggcaagcttttaagaagatga |
153 |
Q |
| |
|
||||| || |||||||| | ||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
40871718 |
ggaaagtcgcatcaagctggatcagatagtttgttgacatggcatgcatttaagaaaatga |
40871658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University