View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_318 (Length: 264)
Name: NF10481A_low_318
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_318 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 5 - 252
Target Start/End: Original strand, 47978639 - 47978886
Alignment:
| Q |
5 |
agcatgttgtcattgaagattgtggacaaattagttgaataagtatatctgctgagaaataagttgatttagatttctcttgaaatcattatagtagtta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47978639 |
agcatgttgtcattgaagattgtggacaaattagttgaataagtatatctgctgagaaataaattgatttagatttctcttgaaatcattatagtagtta |
47978738 |
T |
|
| Q |
105 |
tttacttactatttctttgatgattaagcatgtttgaatgatttttcattgctgctgatatttcatagctgcttatgggttaggaaataatgttttttgt |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47978739 |
tttacttacaatttctttgatgattaagcatgtttgaatgatttttcattgctgctgatatttcatagctgcttatgggttaggaaataatgttttttgt |
47978838 |
T |
|
| Q |
205 |
ttataaattgtaatgcacatgtctttagcatctctttaacttgagaat |
252 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47978839 |
ttataaattgtaatgcatatgtctttagcatctctttaacttgagaat |
47978886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University