View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_322 (Length: 263)
Name: NF10481A_low_322
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_322 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 4 - 256
Target Start/End: Original strand, 45304135 - 45304373
Alignment:
| Q |
4 |
cgactgaaatgaagtaatgcagcttttaggacccttttcatttcccaacaaattactactacaacgaaaccttttcttttcttttcttacctactatact |
103 |
Q |
| |
|
|||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45304135 |
cgacagaaaggaaggaatgcagcttttaggacccttttcatttcccaacaaattactactacaacgaaaccttttcttttctt-----acctact----- |
45304224 |
T |
|
| Q |
104 |
atggtcctttcttactttcccctatacctagttactttgtgcattactgcatataagttactactttttactagttatctaannnnnnnnnnnnnnnatg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45304225 |
atggtcctttcttactttcccctatacctagttactttgtgcattgctgcatataagttactactttttactagttatctaa----tctctctctctatg |
45304320 |
T |
|
| Q |
204 |
catataatcagtgcttagtgggtggataaagatccttatgattattattcctt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45304321 |
catataatcagtgcttagtgggtggataaagatccttatgattattattcctt |
45304373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University