View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_329 (Length: 261)

Name: NF10481A_low_329
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_329
NF10481A_low_329
[»] chr2 (1 HSPs)
chr2 (1-170)||(40810177-40810353)
[»] chr3 (1 HSPs)
chr3 (130-170)||(30937391-30937430)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 40810177 - 40810353
Alignment:
1 aacctgatttctgcattggaaaagtacttttttgaaaatcgctttttggttt-gagttttgaacaaacagagattttctagtgctttggtgatgatgctg 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||    
40810177 aacctgatttctgcattggaaaagtacttttttgaaaatcgctttttggttttgagttttgaacaaacagggattttctagtgctttggtgatgatgctg 40810276  T
100 tctttgtattttgtattctagtgta------tgagattaatctgacaaagctgaaaatgagggaaacaagtggaagg 170  Q
    |||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||||||||    
40810277 tctttgtattttgtattctagtgtatcagattgagattaatctgacaaagctgaaaatgagggaaacaagtggaagg 40810353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 170
Target Start/End: Complemental strand, 30937430 - 30937391
Alignment:
130 ttaatctgacaaagctgaaaatgagggaaacaagtggaagg 170  Q
    |||||||||||| |||||||| |||||||||||||||||||    
30937430 ttaatctgacaa-gctgaaaacgagggaaacaagtggaagg 30937391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University