View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_329 (Length: 261)
Name: NF10481A_low_329
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_329 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 40810177 - 40810353
Alignment:
| Q |
1 |
aacctgatttctgcattggaaaagtacttttttgaaaatcgctttttggttt-gagttttgaacaaacagagattttctagtgctttggtgatgatgctg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40810177 |
aacctgatttctgcattggaaaagtacttttttgaaaatcgctttttggttttgagttttgaacaaacagggattttctagtgctttggtgatgatgctg |
40810276 |
T |
|
| Q |
100 |
tctttgtattttgtattctagtgta------tgagattaatctgacaaagctgaaaatgagggaaacaagtggaagg |
170 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40810277 |
tctttgtattttgtattctagtgtatcagattgagattaatctgacaaagctgaaaatgagggaaacaagtggaagg |
40810353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 170
Target Start/End: Complemental strand, 30937430 - 30937391
Alignment:
| Q |
130 |
ttaatctgacaaagctgaaaatgagggaaacaagtggaagg |
170 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
30937430 |
ttaatctgacaa-gctgaaaacgagggaaacaagtggaagg |
30937391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University