View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_342 (Length: 257)
Name: NF10481A_low_342
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_342 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 34065440 - 34065559
Alignment:
| Q |
137 |
gagtcaaacggtaaattcattacctattatgattctaaacaaaacatgatttggtgacatgtgttaaaatgtgaattgcataatttgcattggcttgtct |
236 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34065440 |
gagtcaaacggtaaat-catgacctattatgattctaaacaaaacatgatttggtgacatgtgttaaaatgtgaattgcataatttgcattggcttgtct |
34065538 |
T |
|
| Q |
237 |
atatatggaataagaaggtga |
257 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
34065539 |
atatatggtataagaaggtga |
34065559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 202 - 242
Target Start/End: Complemental strand, 7643107 - 7643067
Alignment:
| Q |
202 |
aaaatgtgaattgcataatttgcattggcttgtctatatat |
242 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
7643107 |
aaaatgtgaattgaataatttgcattgccttgtctatatat |
7643067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 196
Target Start/End: Complemental strand, 7648037 - 7648003
Alignment:
| Q |
162 |
attatgattctaaacaaaacatgatttggtgacat |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7648037 |
attatgattctaaacaagacatgatttggtgacat |
7648003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University