View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_346 (Length: 256)
Name: NF10481A_low_346
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_346 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 30022623 - 30022384
Alignment:
| Q |
11 |
gtgttatcgctcacttttccttttaattgtcatttttagtctataaacaaagtgacagatactatttaaaattcacacatatgattacgatgttttgggt |
110 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30022623 |
gtgttatcgttcactttttcttttaattgtcatttttagtctataaataaagtgacagacactatttaaaattcacacatatgattatgatgttttgggt |
30022524 |
T |
|
| Q |
111 |
ttaaatttagataaaattgttcatctaagagttagtattcacattattagttaaactagactttagaaaccttta-nnnnnnnccttttcaattagggat |
209 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30022523 |
tcaaatttagataaaattgttcatctaagagttagtattcacattattagttaaactagactttagaaacctttattttttttccttttcaattagggat |
30022424 |
T |
|
| Q |
210 |
taagttgtctcttttataacaaccccacttaactaacgtc |
249 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30022423 |
taagttgtctcttttataacaactccacttaactaacgtc |
30022384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University