View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_356 (Length: 253)
Name: NF10481A_low_356
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_356 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 7815804 - 7815585
Alignment:
| Q |
12 |
agaacctgtggatcatggcatttatttgccttgttcgatgttttccaacaaaaaacatatccaaagcaaatctctaaaatcacattaagaaaacttcaat |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7815804 |
agaacctgaggatcatggcatttatttgccttgttcaatgttttccaacaaaaaacatatccaaagcaaatctctaaaatcacattaagaaaacttcaat |
7815705 |
T |
 |
| Q |
112 |
ggacaaaaccatgtaaatcatgtcatatgtggcatgtgaattatgttccatccgtgtagtttgttgtatttttaaaaggatattatgatgttttattttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7815704 |
ggacaaaaccatgtaaatcatgtcat----------------atgttccatccgtgtagtttgttgtatttttaaaaggatattatgatgttttattttt |
7815621 |
T |
 |
| Q |
212 |
ggattttgctgagacagaaattgctaaggaaacacg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7815620 |
ggattttgctgagacagaaattgctaaggaaacacg |
7815585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University