View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_357 (Length: 251)
Name: NF10481A_low_357
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_357 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 4 - 243
Target Start/End: Complemental strand, 34142454 - 34142215
Alignment:
| Q |
4 |
gtgctcactcataatgactattaaattaaccgtccctctttgagcttgtttatacattattatatagtttatacaattaattgattttgcctcacaaact |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142454 |
gtgctcactcataatgactattaaattaaccgtccctctttgagcttgtttatacattattatatagtttatacaattaattgattttgcctcacaaact |
34142355 |
T |
 |
| Q |
104 |
gggtttttggtagcaagattatggttgcaaatgagtagagctagttcaatgatttttgaatgcttgttattttccatctgatcaaatgctaagttgctaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142354 |
gggtttttggtagcaagattatggttgcaaatgcgtagagctagttcaatgatttttgaatgcttgttattttccatctgatcaaatgctaagttgctaa |
34142255 |
T |
 |
| Q |
204 |
catgttttgcatattgatatttgtggttttcagaacacca |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142254 |
catgttttgcatattgatatttgtggttttcagaacacca |
34142215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University