View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_377 (Length: 250)
Name: NF10481A_low_377
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_377 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 5 - 242
Target Start/End: Original strand, 41103138 - 41103375
Alignment:
| Q |
5 |
caccgagtctaacctgtgaagcaacgacttgcgatctgatcggtgagtttgattccgacgaaaaaattgattcaatttgattccaattttctgaaatcgc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103138 |
caccgagtctaacctgtgaagcaacgacttgcgatctgatcggtgagtttgattccgacgaaaaaattgattcaatttgattccaattttctgaaatcgc |
41103237 |
T |
|
| Q |
105 |
ttcgtataaatcaagcgttctgaacattttctccggagttttcttgcattttgccacgttttccgggaatgcaaacagcatcagtgcgctttctctgcaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
41103238 |
ttcgtataaatcaagcgttctgaacattttctccggagttttcttgcattttgccacgttttccgggaatgcaaacagcattaatgcgctttctctgcaa |
41103337 |
T |
|
| Q |
205 |
atatcagcgaaacacgattctccgatgttgttcttctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103338 |
atatcagcgaaacacgattctccgatgttgttcttctc |
41103375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 94 - 158
Target Start/End: Original strand, 23129044 - 23129108
Alignment:
| Q |
94 |
tctgaaatcgcttcgtataaatcaagcgttctgaacattttctccggagttttcttgcattttgc |
158 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23129044 |
tctgaaattgcttcgtataaatcaagagttctgaacattttctcaggagttttcttgcattttgc |
23129108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University